Doctorado en Genética Humana


Productividad Académica Relevante del Doctorado en Genética Humana.

 

2018
 
 
Insulin glargine affects the expression of Igf-1r, Insr, and Igf-1 genes in colon and liver of diabetic rats.
Juárez-Vázquez C, Gurrola-Díaz C, Vargas-Guerrero B, Domínguez-Rosales J, Rodriguez-Ortiz J, Barros-Núñez, P, Flores-Martínez S, Sánchez-Corona J, Rosales-Reynoso M. (2018).  Iranian Journal of Basic Medical Sciences, 21(5), 489-494. doi: 10.22038/ijbms.2018.24867.6185

 

Expression profile of NF-κB regulated genes in sporadic colorectal cancer patients

González‑Quezada BA, Santana‑Bejarano UF, Corona‑Rivera A, Pimentel‑Gutiérrez HJ, Silva‑Cruz R, Ortega‑de-la-Torre C, Franco‑Topete R, Franco‑Topete K, Centeno‑Flores MW, Maciel‑Gutiérrez VM, Corona‑Rivera JR, Armendáriz‑Borunda J, Bobadilla‑Morales L. Oncology Letters 15.5 (2018): 7344-7354.

 

Ramírez-García SA, García-Cruz D, Cervantes-Aragón I, Bitar-Alatorre WE, Dávalos-Rodríguez IP, Dávalos-Rodríguez NO, Corona-Rivera JR, Sánchez-Corona J. Cir Cir. 2018;86(1):89-98. doi: 10.24875/CIRU.M18000008.
 

Corona-Rivera JR, Bobadilla-Morales L, Corona-Rivera A, Peña-Padilla C, Olvera-Molina S, Orozco-Martín MA, García-Cruz D, Ríos-Flores IM, Gómez-Rodríguez BG, Rivas-Soto G, Pérez-Molina JJ. Congenit Anom (Kyoto). 2018 Feb 19. doi: 10.1111/cga.12276.

 

Becerra-Solano LE, Castañeda-Cisneros G, Corona-Rivera JR, Díaz-Rodríguez M, Figuera LE, López-Muñoz E, Nastasi-Catanese JA, Toscano-Flores JJ, Ramírez-Dueñas ML, García-Ortíz JE. Fetal Pediatr Pathol. 2018 Feb;37(1):27-37. doi: 10.1080/15513815.2017.139266

 

Román-Fernández IV, Sánchez-Zuno GA, Padilla-Gutiérrez JR, Cerpa-Cruz S, Hernández-Bello J, Valle Y, Ramírez-Dueñas MG, Carrillo C, Muñoz-Valle JF. Clin Rheumatol. 2018 Feb;37(2):345-353. doi: 10.1007/s10067-017-3853-9. 
 

Hernández Flores TJ, González García JR, Colima Fausto AG, Vázquez Cárdenas NA, Sánchez López Y, Zarate Morales CA, Magaña Torres MT. J Clin Lipidol. 2018 Mar 1. pii: S1933-2874(18)30066-7. doi: 10.1016/j.jacl.2018.02.015.
 

Castro-Martínez AG, Sánchez-Corona J, Vázquez-Vargas AP, García-Zapién AG, López-Quintero A, Villalpando-Velazco HJ, Flores-Martínez SE. Cell Mol Biol (Noisy-le-grand). 2018 Feb 28;64(3):81-86. doi: 10.14715/cmb/2018.64.3.13.
 

Rosales-Reynoso MA, Juárez-Vázquez CI, Barros-Núñez P. Neurologia. 2018 May;33(4):254-265. doi: 10.1016/j.nrl.2015.06.002. 
 
 
2017
 

Rodríguez-Preciado SY, Magaña-Torres MT, Jaloma Cruz AR, Barros-Núñez P. Int J Immunogenet. 2017 Dec;44(6):279-285. doi: 10.1111/iji.12343. 
 

Rentería-López VM, Perea-Díaz FJ, Rizo-delaTorre LC, Sánchez-López JY, Ibarra-Cortés B. Hemoglobin. 2017 May;41(3):180-184. doi: 10.1080/03630269.2017.1356330. 
 

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ. Int J Lab Hematol. 2017 Oct;39(5):539-545. doi: 10.1111/ijlh.12692. 
 

Córdova-Fletes C, Rivera H, Garza-Villarreal EA, Vázquéz-Cárdenas NA, Martínez-Jacobo LA, Moreno-Andrade T. Clin Dysmorphol. 2017 Jan;26(1):33-37. 
 

Sánchez-Casillas AL, Rivera H, Castro-Martínez AG, García-Ortiz JE, Córdova-Fletes C, Mendoza-Pérez P. Ann Lab Med. 2017 Jan;37(1):88-91. doi: 10.3343/alm.2017.37.1.88.
 

Rivera H. J Korean Med Sci. 2017 Dec;32(12):1908-1909. doi: 10.3346/jkms.2017.32.12.1908.
 

Domínguez MG, Rivera H, Aguilar-Lemarroy A, Jave-Suarez LF, Ramírez-Velazco A, González-Ramos IA, Barros-Núñez P, Partida-Pérez M, Gutiérrez-Amavizca BE, Brambila-Tapia AJ, Figuera LE. Clin Dysmorphol. 2017 Oct;26(4):209-216. doi: 10.1097/MCD.0000000000000191.
 

Wence-Chavez LI, Palomares-Chacon U, Flores-Gutierrez JP, Jave-Suarez LF, Del Carmen Aguilar-Lemarroy A, Barros-Nunez P, Flores-Martinez SE, Sanchez-Corona J, Rosales-Reynoso MA. J BUON2017; 22(5): 1107-1114

 

 

Rosales-Reynoso MA, Wence-Chavez LI, Arredondo-Valdez AR, Dumois-Petersen S, Barros-Núñez P, Gallegos-Arreola MP, Flores-Martínez SE, Sánchez-Corona J. Genet Mol Res. 2017 Jan 23;16(1). doi: 10.4238/gmr16019324.
 

Hernández-Bello J, Oregón-Romero E, Vázquez-Villamar M, García-Arellano S, Valle Y, Padilla-Gutiérrez JR, Román-Fernández IV, Palafox-Sánchez CA, Martínez-Bonilla GE, Muñoz-Valle JF.

Cytokine. 2017 Jul;95:88-96. doi: 10.1016/j.cyto.2017.02.022
 
 

Reynoso-Villalpando GL, Padilla-Gutiérrez JR, Valdez-Haro A, Casillas-Muñoz F, Muñoz-Valle JF, Castellanos-Nuñez E, Chávez-Herrera JC, Valle Y. Genet Test Mol Biomarkers. 2017 May;21(5):334-340. doi: 10.1089/gtmb.2016.0312.
 

Vázquez-Reyes A, Bobadilla-Morales L, Barba-Barba C, Macías-Salcedo G, Serafín-Saucedo G, Velázquez-Rivera ME, Almodóvar-Cuevas MC, Márquez-Mora A, Pimentel-Gutiérrez HJ, Ortega-de-la-Torre C, Cruz-Osorio RM, Nava-Gervasio S, Rivera-Vargas J, Sánchez-Zubieta F, Corona-Rivera JR, Corona-Rivera A. Leuk Res. 2017 Aug;59:117-123. doi: 10.1016/j.leukres.2017.05.022.
 

Peña-Padilla C, Marshall CR, Walker S, Scherer SW, Tavares-Macías G, Razo-Jiménez G, Bobadilla-Morales L, Acosta-Fernández E, Corona-Rivera A, Mendoza-Londono R, Corona-Rivera JR. Clin Genet. 2017 Apr;91(4):640-646. doi: 10.1111/cge.12924. 
 

Martínez-Macías FJ, Bobadilla-Morales L, González-Cruz J, Quiles-Corona M, Corona-Rivera A, Peña-Padilla C, Orozco-Vela M, Silva-Cruz R, Velarde-Rivera F, Corona-Rivera JR. Am J Med Genet A. 2017 Apr;173(4):897-904. doi: 10.1002/ajmg.a.38097.
 

Brambila-Tapia AJL, García-Ortiz JE, Brouillard P, Nguyen HL, Vikkula M, Ríos-González BE, Sandoval-Muñiz RJ, Sandoval-Talamantes AK, Bobadilla-Morales L, Corona-Rivera JR, Arnaud-Lopez L.

Hematology. 2017 Sep;22(8):467-471. doi: 10.1080/10245332.2017.1294551.
 

Sandoval-Pinto E, Padilla-Gutiérrez JR, Hernández-Bello J, Martínez-Fernández DE, Valdés-Alvarado E, Muñoz-Valle JF, Flores-Salinas HE, Valle Y. Gene. 2017 Aug 20;625:31-41. doi: 10.1016/j.gene.2017.05.005. 

 

Muñoz-Valle JF, Padilla-Gutiérrez JR, Hernández-Bello J, Ruiz-Noa Y, Valle Y, Palafox-Sánchez CA, Parra-Rojas I, Gutiérrez-Ureña SR, Rangel-Villalobos H. Med Clin (Barc). 2017 Aug 10;149(3):95-100. doi: 10.1016/j.medcli.2017.01.025.
 
Acculturation impact on some metabolic parameters of the Lacandon communities from Chiapas
 

Mendoza-Carrera F, Castro-Martínez XH, Leal C, Portilla-de Buen E, Sánchez-Corona J, Flores-Martínez SE, García-Zapién A, Ramírez-López G, Gómez-Espinel I, Báez-Duarte BG, Zamora-Ginez I, Velarde-Félix JS, Guillermo Sánchez-Zazueta J. Am J Hum Biol. 2017 Jan;29(1). doi: 10.1002/ajhb.22900.
 

Gallegos-Arreola MP, Márquez-Rosales MG, Sánchez-Corona J, Figuera LE, Zúñiga-González G, Puebla-Pérez AM, Delgado-Saucedo JI, Montoya-Fuentes H. Ann Clin Lab Sci. 2017 May;47(3):291-297.
 

López-Quintero A, García-Zapién AG, Flores-Martínez SE, Díaz-Burke Y, González-Sandoval CE, Lopez-Roa RI, Medina-Díaz E, Muñoz-Almaguer ML, Sánchez-Corona J. Cell Mol Biol (Noisy-le-grand). 2017 Aug 30;63(8):10-18. doi: 10.14715/cmb/2017.63.8.3.
 
 
Factores de riesgo asociados a adenocarcinoma gástrico de patrones histológicos de tipo intestinal y difuso en población adulta del occidente de México.
Delgado-Figueroa N, Casas-Junco P, Torres-Jasso JH, Bustos-Carpinteyro AR, Santiago-Luna E, Marín-Contreras ME, Sánchez-López JY. Gac Med Mex 2017; 153 (2)
 

Bustos-Carpinteyro AR, Magaña-Torres MT, González-García JR, Torres-Jasso JH, Sánchez-López JY. Gac Med Mex. 2017;153(7):830-840. doi: 10.24875/GMM.17002748.
 

Colima Fausto AG, González García JR, Hernández Flores TJ, Vázquez Cárdenas NA, Solís Perales NE, Magaña Torres MT. Ann Lab Med. 2017 Jul;37(4):355-358. doi: 10.3343/alm.2017.37.4.355. 
 

Borjas-Gutiérrez C, Domínguez-Cruz MD, González-García JR. Rev Med Inst Mex Seguro Soc. 2017 Jul-Aug;55(4):481-489.
 

Vázquez-Reyes A, Bobadilla-Morales L, Barba-Barba C, Macías-Salcedo G, Serafín-Saucedo G, Velázquez-Rivera ME, Almodóvar-Cuevas MC, Márquez-Mora A, Pimentel-Gutiérrez HJ, Ortega-de-la-Torre C, Cruz-Osorio RM, Nava-Gervasio S, Rivera-Vargas J, Sánchez-Zubieta F, Corona-Rivera JR, Corona-Rivera A. Leuk Res. 2017 Aug;59:117-123. doi: 10.1016/j.leukres.2017.05.022.
 

Peña-Padilla C, Marshall CR, Walker S, Scherer SW, Tavares-Macías G, Razo-Jiménez G, Bobadilla-Morales L, Acosta-Fernández E, Corona-Rivera A, Mendoza-Londono R, Corona-Rivera JR. Clin Genet. 2017 Apr;91(4):640-646. doi: 10.1111/cge.12924.
 

Jiménez-Arredondo RE, Brambila-Tapia AJ, Mercado-Silva FM, Ortiz-Aranda M, Benites-Godinez V, Olmos-García-de-Alba G, Figuera LE. Neurol Sci. 2017 Mar;38(3):445-450. doi: 10.1007/s10072-016-2788-2. 
 

Alonzo-Rojo A, García-Ortiz JE, Ortiz-Aranda M, Gallegos-Arreola MP, Figuera-Villanueva LE.

Genet Mol Res. 2017 Sep 21;16(3). doi: 10.4238/gmr16032602.
 

Jiménez-Arredondo RE, Brambila-Tapia AJL, Mercado-Silva FM, Magaña-Torres MT, Figuera LE.

Genet Mol Res. 2017 May 18;16(2). doi: 10.4238/gmr16029405.
 

Gutiérrez-Amavizca BE, Gal A, Ortíz-Orozco R, Orth U, Prado Montes De Oca E, Gutiérrez-Amavizca JP, Figuera LE. J Genet. 2017 Mar;96(1):161-164.
 

Santos RD, Bourbon M, Alonso R, Cuevas A, Vasquez-Cardenas NA, Pereira AC, Merchan A, Alves AC, Medeiros AM, Jannes CE, Krieger JE, Schreier L, Perez de Isla L, Magaña-Torres MT, Stoll M, Mata N, Dell Oca N, Corral P, Asenjo S, Bañares VG, Reyes X, Mata P; Ibero-American Familial Hypercholesterolemia Network. J Clin Lipidol. 2017 Jan - Feb;11(1):160-166. doi: 10.1016/j.jacl.2016.11.004.
 

Lima-Martínez MM, Paoli M, Vázquez-Cárdenas A, Magaña-Torres MT, Guevara O, Muñoz MC, Parrilla-Alvarez A, Márquez Y, Medeiros A, Bourbon M. Endocrinol Diabetes Nutr. 2017 Oct;64(8):432-439. doi: 10.1016/j.endinu.2017.05.007.
 

Rossi BM, Palmero EI, López-Kostner F, Sarroca C, Vaccaro CA, Spirandelli F, Ashton-Prolla P, Rodriguez Y, de Campos Reis Galvão H, Reis RM, Escremim de Paula A, Capochin Romagnolo LG, Alvarez K, Della Valle A, Neffa F, Kalfayan PG, Spirandelli E, Chialina S, Gutiérrez Angulo M, Castro-Mujica MDC, Sanchez de Monte J, Quispe R, da Silva SD, Rossi NT, Barletta-Carrillo C, Revollo S, Taborga X, Morillas LL, Tubeuf H, Monteiro-Santos EM, Piñero TA, Dominguez-Barrera C, Wernhoff P, Martins A, Hovig E, Møller P, Dominguez-Valentin M. BMC Cancer. 2017 Sep 5;17(1):623. doi: 10.1186/s12885-017-3599-4.
 

Valdez-Haro A, Valle Y, Valdes-Alvarado E, Casillas-Muñoz F, Muñoz-Valle JF, Reynoso-Villalpando GL, Flores-Salinas HE, Padilla-Gutiérrez JR. Genet Mol Res. 2017 Sep 27;16(3). doi: 10.4238/gmr16039779.
 

Sandoval-Pinto E, Padilla-Gutiérrez JR, Hernández-Bello J, Martínez-Fernández DE, Valdés-Alvarado E, Muñoz-Valle JF, Flores-Salinas HE, Valle Y. Gene. 2017 Aug 20;625:31-41. doi: 10.1016/j.gene.2017.05.005.
 

Muñoz-Valle JF, Padilla-Gutiérrez JR, Hernández-Bello J, Ruiz-Noa Y, Valle Y, Palafox-Sánchez CA, Parra-Rojas I, Gutiérrez-Ureña SR, Rangel-Villalobos H. Med Clin (Barc). 2017 Aug 10;149(3):95-100. doi: 10.1016/j.medcli.2017.01.025
 
 
2016

 

López-Jiménez JJ, Porras-Dorantes Á, Juárez-Vázquez CI, García-Ortiz JE, Fuentes-Chávez CA, Lara-Navarro IJ, Jaloma-Cruz AR. Genet Mol Res. 2016 Oct 5;15(4). doi: 10.4238/gmr.15048728.
 

Vásquez-Velásquez AI, Rivera H, Castro AG, Jaloma-Cruz AR, Juárez CI, Lara-Navarro IJ, Córdova-Fletes C, Mendoza-Pérez P, García-Ortiz JE. Taiwan J Obstet Gynecol. 2016 Apr;55(2):275-80. doi: 10.1016/j.tjog.2015.09.004.

 

de-la-Cruz-Salcedo EI, Ibarra B, Rizo-de-la-Torre LC, Sánchez-López JY, González-Mercado A, Harteveld CL, Perea-Díaz FJ. Int J Lab Hematol. 2016 Oct;38(5):535-42. doi: 10.1111/ijlh.12536

 

Orozco-Gutiérrez MH, Sánchez-Corona J, García-Ortiz JE, Castañeda-Cisneros G, Dávalos-Rodríguez NO, Corona-Rivera JR, García-Cruz D. Arch Argent Pediatr. 2016 Oct 1;114(5):e314-8. doi: 10.5546/aap.2016.e314

 

Rivera H, Vésquez-Velásquez AI, DomÍnguez-Quezada MG, RamÍrez-Velazco A. J Genet. 2016 Mar;95(1):157-9

 

Rosales-Reynoso MA, Arredondo-Valdez AR, Wence-Chávez LI, Barros-Núñez P, Gallegos-Arreola MP, Flores-Martínez SE, Sánchez-Corona J. Genet Test Mol Biomarkers. 2016 Aug;20(8):438-44. doi: 10.1089/gtmb.2016.0026

 

Rosales-Reynoso MA, Ochoa-Hernández AB, Juárez-Vázquez CI, Barros-Núñez P. Neurologia. 2016 Nov - Dec;31(9):628-638. doi: 10.1016/j.nrl.2014.02.004.

 

Rosales-Reynoso MA, Arredondo-Valdez AR, Juárez-Vázquez CI, Wence-Chavez LI, Barros-Núñez P, Gallegos-Arreola MP, Flores-Martínez SE, Morán-Moguel MC, Sánchez-Corona J.

Cell Mol Biol (Noisy-le-grand). 2016 Sep 30;62(11):13-20

 

Corona-Rivera JR, Nieto-García R, López-Marure E, Cárdenas-Ruiz Velasco JJ, Bobadilla-Morales L, Mellín-Sánchez EL, Aguirre-Guillén RL, Pérez-Ramírez RO, Zapata-Aldana E, Sandoval-Talamantes AK, Solís-Ledezma S, Corona-Rivera A, Gómez-Ruiz LM. Am J Med Genet A. 2016 Feb;170A(2):316-21. doi: 10.1002/ajmg.a.37433
 

Pimentel-Gutiérrez HJ, Bobadilla-Morales L, Barba-Barba CC, Ortega-De-La-Torre C, Sánchez-Zubieta FA, Corona-Rivera JR, González-Quezada BA, Armendáriz-Borunda JS, Silva-Cruz R, Corona-Rivera A. Oncol Lett. 2016 Nov;12(5):4117-4124.
 

Corona-Rivera JR, Pérez-Cortés G, Osuna-Osuna J, Garay-Cortés MG, Pérez-Molina JJ, Ramírez-Godínez S, Peña-Padilla C, Rivera-Vargas J, Bobadilla-Morales L. Rev Med Inst Mex Seguro Soc. 2016 Mar-Apr;54(2):146-50

 

Moreno-Ortiz JM, Ayala-Madrigal Mde L, Corona-Rivera JR, Centeno-Flores M, Maciel-Gutiérrez V, Franco-Topete RA, Armendáriz-Borunda J, Hotchkiss E, Pérez-Carbonell L, Rhees J, Boland CR, Gutiérrez-Angulo M. Gastroenterol Res Pract. 2016;2016:5278024. doi: 10.1155/2016/5278024
 

Corona-Rivera JR, Zapata-Aldana E, Bobadilla-Morales L, Corona-Rivera A, Peña-Padilla C, Solis-Hernández E, Guzmán C, Richmond E, Zahl C, Zenker M, Sukalo M. Am J Med Genet A. 2016 Jun;170(6):1495-501. doi: 10.1002/ajmg.a.37630
 
 

Martínez-Cortés G, García-Aceves M, Favela-Mendoza AF, Muñoz-Valle JF, Velarde-Felix JS, Rangel-Villalobos H. Int J Legal Med. 2016 May;130(3):683-5. doi: 10.1007/s00414-015-1242-y.
 
 

Bustos-Carpinteyro AR, Delgado-Figueroa N, Santiago-Luna E, Magaña-Torres MT, Sánchez-López JY. Genet Mol Res. 2016 Sep 16;15(3). doi: 10.4238/gmr.15038715.
 

Torres-Jasso JH, Bustos-Carpinteyro AR, Garcia-Gonzalez JR, Peregrina-Sandoval J, Cruz-Ramos JA, Santiago-Luna E, Sanchez-Lopez JY. Indian J Cancer. 2016 Jul-Sep;53(3):345-348. doi: 10.4103/0019-509X.200648.
 

Barajas Torres RL, Domínguez Cruz MD, Borjas Gutiérrez C, Ramírez Dueñas Mde L, Magaña Torres MT, González García JR. Cytogenet Genome Res. 2016;148(2-3):179-84. doi: 10.1159/000445858
 

Meza-Espinoza JP, Romo Martínez EJ, Aguilar López L, Picos Cárdenas VJ, Magaña Torres MT, González García JR. Ann Lab Med. 2016 Mar;36(2):185-7. doi: 10.3343/alm.2016.36.2.185.
 

Borjas-Gutierrez C, Gonzalez-Garcia JR. Mol Cytogenet. 2016 Nov 21;9:83
 

Colima Fausto AG, González García JR, Wong Ley Madero LE, Magaña Torres MT. J Clin Lipidol. 2016 Jan-Feb;10(1):204-8. doi: 10.1016/j.jacl.2015.09.011
 

Gutiérrez-Hurtado IA, Puebla-Pérez AM, Delgado-Saucedo JI, Figuera LE, Zúñiga-González GM, Gomez-Mariscal K, Ronquillo-Carreón CA, Gallegos-Arreola MP.

Genet Mol Res. 2016 Jul 14;15(2). doi: 10.4238/gmr.15028199.
 

Marin-Medina A, Brambila-Tapia AJ, Picos-Cárdenas VJ, Gallegos-Arreola MP, Figuera LE. Genet Mol Res. 2016 Oct 24;15(4). doi: 10.4238/gmr15047802.
 

Bustos-Carpinteyro AR, Delgado-Figueroa N, Santiago-Luna E, Magaña-Torres MT, Sánchez-López JY. Genet Mol Res. 2016 Sep 16;15(3). doi: 10.4238/gmr.15038715.
 

Saldaña-Cruz AM, León-Moreno LC, Sánchez-Corona J, Santiago DA, Mendoza-Carrera F, Castro-Martínez XH, García-Zapién AG, Morán-Moguel MC, Flores-Martínez SE. Genet Test Mol Biomarkers. 2016 Nov;20(11):702-709.
 
 
 
Association of the rs2279744 Promoter Polymorphism in the MDM2 Gene with Breast Cancer in a Mexican Population.
Márquez-Rosales MG, Sánchez-Corona J, Figuera LE, Montoya- Fuentes H, Zúñiga-González GM, et al. (2016) . Hereditary Genet 5:165. doi:10.4172/2161 1041.1000165
 
Association Of A HER2 Ile655Val (Rs1136201) Polymorphism in Breast Cancer in A Mexican Population.

Carrillo-Moreno DI, Figuera LE, Magaña-Torres MT, Zúñiga-González G, Puebla-Pérez AM, Gallegos-Arreola MP (2016). World Journal of Research and Review (WJRR) ISSN:2455-3956, Volume-3, Issue-3, September 2016 Pages 15-20
 
Association of extrapituitary prolactin promoter polymorphism with disease susceptibility and anti-RNP antibodies in Mexican patients with systemic lupus erythematosus
Jorge Hernández-Bello, Claudia A. Palafox-Sanchez, Samuel García-Arellano, Zyanya Reyes-Castillo, Ana L. Pereira-Suárez, Isela Parra-Rojas, José E. Navarro-Zarza, Ulises De la cruz-Mosso, Nora M. Torres-Carrillo, José Francisco Muñoz-Valle. Arch Med Sci 2016. DOI: https://doi.org/10.5114/aoms.2016.62138
 
 
2015
 

Zavelia Padilla-Romo MG, Jaloma-Cruz AR. Gac Med Mex. 2015 May-Jun;151(3):399-402. Spanish.
 

González-Ramos IA, Jaloma-Cruz AR. Gac Med Mex. 2015 Mar-Apr;151(2):266-9. Spanish.

 

Luna-Záizar H, González-Moncada AI, Padilla-López EL, Ramírez-Anguiano AC, Pacheco-Moisés FP, Velasco-Ramírez SF, Padilla-Romo MG, Borjas-Gutierrez C, Jaloma-Cruz AR. Thromb Res. 2015 Dec;136(6):1291-8. doi: 10.1016/j.thromres.2015.10.026.

 

Vásquez-Velásquez AI, Rivera H, Castro AG, Jaloma-Cruz AR, Juárez CI, Lara-Navarro IJ, Córdova-Fletes C, Mendoza-Pérez P, García-Ortiz JE. Taiwan J Obstet Gynecol. 2016 Apr;55(2):275-80. doi: 10.1016/j.tjog.2015.09.004.
 

Casas-Castañeda M, Ibarra B, Rizo-De La Torre LC, Sánchez-López JY, Magaña-Torres MT. Am J Hum Biol. 2015 Sep-Oct;27(5):697-703. doi: 10.1002/ajhb.22691.

 

Torres-Jasso JH, Marín ME, Santiago-Luna E, Leoner JC, Torres J, Magaña-Torres MT, Perea FJ, Ibarra B, Sánchez-López JY. Genet Mol Res. 2015 Mar 13;14(1):1802-7. doi: 10.4238/2015.March.13.8.
 

Orozco-Gutiérrez MH, Cervantes-Aragón I, García-Cruz D. Neurologia. 2017 Sep;32(7):469-475. doi: 10.1016/j.nrl.2015.06.004.

 

Rivera H, Vásquez-Velásquez AI. J Bioeth Inq. 2015 Mar;12(1):21-3. doi: 10.1007/s11673-015-9620-1.
 

Córdova-Fletes C, Domínguez MG, Delint-Ramirez I, Martínez-Rodríguez HG, Rivas-Estilla AM, Barros-Núñez P, Ortiz-López R, Neira VA. Neurogenetics. 2015 Oct;16(4):287-98. doi: 10.1007/s10048-015-0452-2.

 

Rosales-Reynoso MA, Juárez-Vázquez CI, Barros-Núñez P. Neurologia. 2018 May;33(4):254-265. doi: 10.1016/j.nrl.2015.06.002.

 

García-González IJ, Valle Y, Sandoval-Pinto E, Valdés-Alvarado E, Valdez-Haro A, Muñoz-Valle JF, Flores-Salinas HE, Figuera-Villanueva LE, Dávalos-Rodríguez NO, Padilla-Gutiérrez JR. Dis Markers. 2015;2015:460974. doi: 10.1155/2015/460974.
 
Assessment of the +3142 C>G polymorphism of HLA-G and HINDIII C>G polymorphism of PAI-1 in acute coronary syndrome in Mexican population
 

García-González IJ, Valle Y, Sandoval-Pinto E, Valdés-Alvarado E, Valdez-Haro A, Muñoz-Valle JF, Flores-Salinas HE, Figuera-Villanueva LE, Dávalos-Rodríguez NO, Padilla-Gutiérrez JR.

Dis Markers. 2015;2015:460974. doi: 10.1155/2015/460974.

 

Aguirre-Guillén RL, Santoyo-Duran R, Tapia-Hernández R, González-Bernal C, Tostado-Rabago EA, Díaz-Silva M, Valero-Rodríguez DL, Mellín-Sánchez EL, Corona-Rivera JR.

Clin Dysmorphol. 2015 Oct;24(4):163-5. doi: 10.1097/MCD.0000000000000089.

 

Estrada-Padilla SA, Corona-Rivera JR, Sánchez-Zubieta F, Bobadilla-Morales L, Corona-Rivera A. An Pediatr (Barc). 2015 Feb;82(2):75-82. doi: 10.1016/j.anpedi.2013.11.029.

 

Bobadilla-Morales L, Pimentel-Gutiérrez HJ, Gallegos-Castorena S, Paniagua-Padilla JA, Ortega-de-la-Torre C, Sánchez-Zubieta F, Silva-Cruz R, Corona-Rivera JR, Zepeda-Moreno A, González-Ramella O, Corona-Rivera A. Mol Cytogenet. 2015 Jan 31;8:5. doi: 10.1186/s13039-014-0105-4.

 

Robledo-Aceves M, Bobadilla-Morales L, Mellín-Sánchez EL, Corona-Rivera A, Pérez-Molina JJ, Cárdenas-Ruiz Velasco JJ, Corona-Rivera JR. Congenit Anom (Kyoto). 2015 May;55(2):73-80. doi: 10.1111/cga.12087.

 

Corona-Rivera JR, Barrios-Prieto E, Nieto-García R, Bloise R, Priori S, Napolitano C, Bobadilla-Morales L, Corona-Rivera A, Zapata-Aldana E, Peña-Padilla C, Rivera-Vargas J, Chavana-Naranjo E. Eur J Med Genet. 2015 Jun-Jul;58(6-7):332-5. doi: 10.1016/j.ejmg.2015.04.001.

 

Salazar-Flores J, Zuñiga-Chiquette F, Rubi-Castellanos R, Álvarez-Miranda JL, Zetina-Hérnandez A, Martínez-Sevilla VM, González-Andrade F, Corach D, Vullo C, Álvarez JC, Lorente JA, Sánchez-Diz P, Herrera RJ, Cerda-Flores RM, Muñoz-Valle JF, Rangel-Villalobos H.

Homo. 2015 Feb;66(1):44-59. doi: 10.1016/j.jchb.2014.08.005.

 

Martínez-Cortés G, Gusmão L, Pereira R, Salcido VH, Favela-Mendoza AF, Muñoz-Valle JF, Inclán-Sánchez A, López-Hernández LB, Rangel-Villalobos H. Forensic Sci Int Genet. 2015 Jul;17:149-152. doi: 10.1016/j.fsigen.2015.04.011.

 

Flores-Martínez SE, Castro-Martínez AG, López-Quintero A, García-Zapién AG, Torres-Rodríguez RN, Sánchez-Corona J. Cir Cir. 2015 Jan-Feb;83(1):35-42. doi: 10.1016/j.circir.2015.04.021.

 

Wegman-Ostrosky T, Soto-Reyes E, Vidal-Millán S, Sánchez-Corona J. Renin Angiotensin Aldosterone Syst. 2015 Jun;16(2):227-33. doi: 10.1177/1470320313496858.

 

González García JR, Cruz MD, Gutiérrez CB.

Mol Cytogenet. 2015 Feb 22;8:14. doi: 10.1186/s13039-015-0116-9.

 

Gallegos-Arreola MP, Figuera LE, Flores-Ramos LG, Puebla-Pérez AM, Zúñiga-González GM.

Arch Med Sci. 2015 Jun 19;11(3):551-60. doi: 10.5114/aoms.2015.52357.

 

 

Ramos-Silva A, Figuera LE, Soto-Quintana OM, Puebla-Pérez AM, Ramírez-Patiño R, Gutiérrez-Hurtado I, Carrillo-Moreno DI, Zúñiga-González GM, Dávalos-Rodríguez IP, Gallegos-Arreola MP.

Genet Mol Res. 2015 Apr 27;14(2):4015-26. doi: 10.4238/2015.April.27.16.

 

Soto-Quintana O, Zúñiga-González GM, Ramírez-Patiño R, Ramos-Silva A, Figuera LE, Carrillo-Moreno DI, Gutiérrez-Hurtado IA, Puebla-Pérez AM, Sánchez-Llamas B, Gallegos-Arreola MP.

Genet Mol Res. 2015 Oct 26;14(4):13066-75. doi: 10.4238/2015.October.26.2.

 

 

Analysis of ERCC1 and ERCC2 gene variants in osteosarcoma, colorectal and breast cancer
Gómez-Díaz B, Ayala-Madrigal ML, Gutiérrez-Angulo M, Erazo Valle-Solis A, Linares-González LM, González-Guzmán R, Cruz-Guillén D, Cedeño-Garcidueñas AL, Canto P, López-Hernández LB. (2015) doi.org/10.3892/ol.2015.2894

 

Ramírez-Ramírez R, Gutiérrez-Angulo M, Magaña MT, Moreno-Ortiz JM, Partida-Pérez M, Muñiz-Mendoza R, Peregrina-Sandoval J, Suárez-Villanueva AS, Centeno-Flores M, Maciel-Gutiérrez VM, Cabrales-Vazquez E, Ayala-Madrigal ML. Genet Mol Res. 2015 Jan 23;14(1):362-7. doi: 10.4238/2015.January.23.9.
 

Suárez-Villanueva S, Ayala-Madrigal ML, Peregrina-Sandoval J, Macías-Gómez N, Ramírez-Ramírez R, Muñiz-Mendoza R, Moreno-Ortiz JM, Centeno-Flores M, Maciel-Gutiérrez V, Cabrales E, Gutiérrez-Angulo M. Genet Mol Res. 2015 Dec 1;14(4):15505-10. doi: 10.4238/2015.
 

Da Silva-José TD, Juárez-Rendón KJ, Juárez-Osuna JA, Porras-Dorantes A, Valladares-Salgado A, Cruz M, Gonzalez-Ibarra M, Soto AG, Magaña-Torres MT, Sandoval-Ramírez L, García-Ortiz JE. JIMD Rep. 2015;23:123-7. doi: 10.1007/8904_2015_442.
 

Torres-Jasso JH, Marín ME, Santiago-Luna E, Leoner JC, Torres J, Magaña-Torres MT, Perea FJ, Ibarra B, Sánchez-López JY. Genet Mol Res. 2015 Mar 13;14(1):1802-7. doi: 10.4238/2015.March.13.8.
                                                                                                               

Zúñiga-González GM, Gómez-Meda BC, Zamora-Perez AL, Martínez-González MA, Muñoz de Haro IA, Pérez-Navarro AE, Armendáriz-Borunda J, Gallegos-Arreola MP.

Mutat Res Genet Toxicol Environ Mutagen. 2015 Apr;782:36-41. doi: 10.1016/j.mrgentox.2015.03.013.

 

Peralta-Leal V, Leal-Ugarte E, Gutiérrez-Angulo M, Dávalos-Rodríguez IP, Gallegos-Arreola MP, Meza-Espinoza JP, Torres-Benavides HG, Peregrina-Sandoval J, Villarreal-Sotelo K, Ondarza Rodríguez MM, Nair S, Durán-González J.

Psychiatr Genet. 2015 Aug;25(4):178-9. doi: 10.1097/YPG.0000000000000089.
 

Macías-Gómez NM, Peralta-Leal V, Meza-Espinoza JP, Gutiérrez-Angulo M, Durán-González J, Ramírez-González JM, Gaspar-Del Toro A, Norberto-Rodríguez A, Leal-Ugarte E.

Fam Cancer. 2015 Sep;14(3):349-54. doi: 10.1007/s10689-015-9787-y.
 
 

Flores-Martínez SE, Castro-Martínez AG, López-Quintero A, García-Zapién AG, Torres-Rodríguez RN, Sánchez-Corona J. Cir Cir. 2015 Jan-Feb;83(1):35-42. doi: 10.1016/j.circir.2015.04.021. Spanish.
 
 
2014
 

Luna-Záizar H, Beltrán-Miranda CP, Esparza-Flores MA, Soto-Padilla J, Bergés-García A, Rodríguez-Zepeda MD, Pompa-Garza MT, Jaloma-Cruz AR. Haemophilia. 2014 Jan;20(1):e7-14. doi: 10.1111/hae.12309.
 
 

Quintero-Ramos A, Gutiérrez-Rubio SA, Del Toro-Arreola A, Franco-Topete RA, Oceguera-Villanueva A, Jiménez-Pérez LM, Castro-Cervantes JM, Barragán-Ruiz A, Vázquez-Camacho JG, Daneri-Navarro A. Genet Mol Res. 2014 Oct 27;13(4):8749-56. doi: 10.4238/2014.October.27.16.

 

Ríos-González BE, Ibarra-Cortés B, Ramírez-López G, Sánchez-Corona J, Magaña-Torres MT. Dis Markers. 2014;2014:150358. doi: 10.1155/2014/150358.
 

Ramírez-Velasco A, Rivera H. Gene. 2014 Sep 10;548(1):155-7. doi: 10.1016/j.gene.2014.07.013.

 

Córdova-Fletes C, Sáinz-González E, Avendaño-Gálvez RI, Ramírez-Velazco A, Rivera H, Ortiz-López R, Arámbula-Meraz E, Picos-Cárdenas VJ. J Genet. 2014 Dec;93(3):869-73
 

Salinas-Torres VM, Rivera H. Genet Couns. 2014;25(1):29-33.

 

Rivera H. Andrologia. 2014 Sep;46(7):707. doi: 10.1111/and.12266. No abstract available.

 

Rivera H.Taiwan J Obstet Gynecol. 2014 Mar;53(1):135. doi: 10.1016/j.tjog.2013.10.039. 

García-Castillo H, Leal-Ugarte E, Ortiz Lazareno PC, Barrera-Chairez E, Rosales-García VH, Barros-Núñez P. Med Oncol. 2014 Apr;31(4):900. doi: 10.1007/s12032-014-0900-0.

 

Gutiérrez-Amavizca BE, Orozco-Castellanos R, R Padilla-Gutiérrez J, Valle Y, Figuera LE. Genet Mol Res. 2014 Aug 28;13(3):6752-8. doi: 10.4238/2014

 

García-González IJ, Valle Y, Rivas F, Figuera-Villanueva LE, Muñoz-Valle JF, Flores-Salinas HE, Gutiérrez-Amavizca BE, Dávalos-Rodríguez NO, Padilla-Gutiérrez JR. Biomed Res Int. 2014;2014:898159. doi: 10.1155/2014/898159.

 

Corona-Rivera JR, Acosta-León J, León-Hernández MÁ, Martínez-Macías FJ, Bobadilla-Morales L, Corona-Rivera A. Am J Med Genet A. 2014 Jan;164A(1):199-203. doi: 10.1002/ajmg.a.36210

 

Ríos-González BE, Ibarra-Cortés B, Ramírez-López G, Sánchez-Corona J, Magaña-Torres MT.

Dis Markers. 2014;2014:150358. doi: 10.1155/2014/150358

 

Baez-Duarte BG, Mendoza-Carrera F, García-Zapién A, Flores-Martínez SE, Sánchez-Corona J, Zamora-Ginez I, Torres-Rasgado E, León-Chávez BA, Pérez-Fuentes R; Multidisciplinary Research Group on Diabetes of the Instituto Mexicano del Seguro Social. Arch Med Res. 2014 Jul;45(5):375-82. doi: 10.1016/j.arcmed.2014.05.001.

 

Castro-Martínez XH, Leal-Cortés C, Flores-Martínez SE, García-Zapién AG, Sánchez-Corona J, Portilla-de Buen E, Gómez-Espinel I, Zamora-Ginez I, Pérez-Fuentes R, Islas-Andrade S, Revilla-Monsalve C, Guerrero-Romero F, Rodríguez-Morán M, Mendoza-Carrera F. Tissue Antigens. 2014 Apr;83(4):247-59. doi: 10.1111/tan.12300.

 

Brambila-Tapia AJ, Neira VA, Vásquez-Velásquez AI, Jimenez-Arredondo RE, Chávez-González EL, Picos-Cárdenas VJ, Fletes-Rayas AL, Figuera LE. Genet Couns. 2014;25(3):289-97.

 

Moreno-Ortiz JM, Gutiérrez-Angulo M, Partida-Pérez M, Peregrina-Sandoval J, Ramírez-Ramírez R, Muñiz-Mendoza R, Suárez-Villanueva S, Centeno-Flores M, Maciel-Gutiérrez V, Cabrales-Vazquez JE, Ayala-Madrigal ML. Genet Mol Res. 2014 Feb 14;13(2):3537-44. doi: 10.4238/2014.February.14.1.

 

Macías-Gómez NM, Gutiérrez-Angulo M, Leal-Ugarte E, Ramírez-Reyes L, Peregrina-Sandoval J, Meza-Espinoza JP, Ramos Solano F, de la Luz Ayala-Madrigal M, Santoyo Telles F. Genet Mol Res. 2014 Jul 4;13(3):5018-24. doi: 10.4238/2014.July.4.17.

 

Magaña Torres MT, Mora-Hernández S, Vázquez Cárdenas NA, González Jaimes A. J Clin Lipidol. 2014 Sep-Oct;8(5):525-7. doi: 10.1016/j.jacl.2014.05.002.
 

Gallegos-Arreola MP, Figuera-Villanueva LE, Ramos-Silva A, Salas-González E, Puebla-Pérez AM, Peralta-Leal V, García-Ortiz JE, Dávalos-Rodríguez IP, Zúñiga-González GM. Arch Med Sci. 2014 Dec 22;10(6):1214-24. doi: 10.5114/aoms.2014.47830.
 

Moreno-Ortiz JM, Gutiérrez-Angulo M, Partida-Pérez M, Peregrina-Sandoval J, Ramírez-Ramírez R, Muñiz-Mendoza R, Suárez-Villanueva S, Centeno-Flores M, Maciel-Gutiérrez V, Cabrales-Vazquez JE, Ayala-Madrigal ML. Genet Mol Res. 2014 Feb 14;13(2):3537-44. doi: 10.4238/2014.February.14.1.
 
 

2013
 
Significance of linkage disequilibrium heterogeneous patterns in the 21q22.3 region for mapping 21 trisomy individuals. Valle Y, Padilla-Gutiérrez JR, Quintero-Ramos A, García-González IJ, Rivas F. Genet Mol Res. 2013 Aug 8;12(3):2821-8. doi: 10.4238/2013.August.8.2.
Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women. González-Mercado A, Sánchez-López JY, Regla-Nava JA, Gámez-Nava JI, González-López L, Duran-Gonzalez J, Celis A, Perea-Díaz FJ, Salazar-Páramo M, Ibarra B. Genet Mol Res. 2013 Jul 30;12(3):2755-63. doi: 10.4238/2013.July.30.13.
De novo dup p/del q or dup q/del p rearranged chromosomes: review of 104 cases of a distinct chromosomal mutation.Rivera H, Domínguez MG, Vásquez-Velásquez AI, Lurie IW. Cytogenet Genome Res. 2013;141(1):58-63. doi: 10.1159/000351184.
Factores de riesgo para osteoporosis en mujeres posmenopáusicas de Guadalajara, Jalisco.Gonzalez-Mercado, Anahí; Sanchez-Lopez, J Yoaly  Y  Ibarra, Bertha. Salud Pública Méx. 2013, Vol.55, N.6, Pp.627-630.
DNA repair/replication transcripts are down regulated in patients with Fragile X Syndrome. Xu H, Rosales-Reynoso MA, Barros-Núñez P, Peprah E. BMC Res Notes. 2013 Mar 11;6:90. doi: 10.1186/1756-0500-6-90.
[Ataxia telangiectasia. Diagnosis and follow-up in 4 cases]. Monterrubio Ledezma CE, Corona Rivera A, Corona Rivera JR, Rodríguez Casillas LJ, Hernández Rocha J, Barros Nuñez P, Bobadilla Morales L. Gac Med Mex. 2013 Jul-Aug;149(4):448-53. Spanish.
De novo MECP2 disomy in a Mexican male carrying a supernumerary marker chromosome and no typical Lubs syndrome features. Neira VA, Romero-Espinoza P, Rojas-Martínez A, Ortiz-López R, Córdova-Fletes C, Plaja A, Barros-Núñez P. Gene. 2013 Jul 25;524(2):381-5. doi: 10.1016/j.gene.2013.04.029.
Neuhauser syndrome: a rare association of megalocornea and mental retardation. Review of the literature and further phenotype delineation.Gutiérrez-Amavizca BE, Juárez-Vázquez CI, Orozco-Castellanos R, Arnaud L, Macías-Gómez NM, Barros-Nuñez P. Genet Couns. 2013;24(2):185-91
Contribution of GSTM1, GSTT1, and MTHFR polymorphisms to end-stage renal disease of unknown etiology in Mexicans.Gutiérrez-Amavizca BE, Orozco-Castellanos R, Ortíz-Orozco R, Padilla-Gutiérrez J, Valle Y, Gutiérrez-Gutiérrez N, García-García G, Gallegos-Arreola M, Figuera LE. Indian J Nephrol. 2013 Nov;23(6):438-43. doi: 10.4103/0971-4065.120342.
Genetic contribution of CYP2C9, CYP2C19, and APOE variants in acenocoumarol response. Nastasi-Catanese JA, Padilla-Gutiérrez JR, Valle Y, Ortega-Gutiérrez F, Gallegos-Arreola MP, Figuera LE. Genet Mol Res. 2013 Oct 10;12(4):4413-21. doi: 10.4238/2013.October.10.7.
Role of toll-interacting protein gene polymorphisms in leprosy Mexican patients. Montoya-Buelna M, Fafutis-Morris M, Tovar-Cuevas AJ, Alvarado-Navarro A, Valle Y, Padilla-Gutierrez JR, Muñoz-Valle JF, Figuera-Villanueva LE. Biomed Res Int. 2013;2013:459169. doi: 10.1155/2013/459169.

Aplasia cutis congenita of the scalp in a female infant with anophthalmia/microphthalmia-esophageal atresia syndrome negative for SOX2 mutation.Corona-Rivera JR, Zenteno JC, Pelcastre-Luna E, Miguel-Jiménez K, Aguirre-Guillén RL, Cabral-Macías J, Peña-Padilla C, Bobadilla-Morales L, Corona-Rivera A. Am J Med Genet A. 2013 May;161A(5):1189-93. doi: 10.1002/ajmg.a.35854.

Confirmation of the macroblepharon, ectropion, hypertelorism, and macrostomia syndrome.Corona-Rivera JR, Bobadilla-Morales L, Corona-Rivera A, Aguirre-Guillén RL, López-Marure E, Mellin-Sánchez EL. Clin Dysmorphol. 2013 Apr;22(2):81-3. doi: 10.1097/MCD.0b013e3283602830.

Dysgnathia complex sine holoprosencephaly nor synotia: a case report and discussion of its nosology.Corona-Rivera JR, Trujillo-Ponce SA, Barrios-Prieto E, Quiles-Corona M, Miguel-Jimenez K, Aguirre-Guillen RL, Bobadilla-Morales L, Corona-Rivera A. Genet Couns. 2013;24(1):45-55.

Yunis-Varón syndrome is caused by mutations in FIG4, encoding a phosphoinositide phosphatase.Campeau PM, Lenk GM, Lu JT, Bae Y, Burrage L, Turnpenny P, Román Corona-Rivera J, Morandi L, Mora M, Reutter H, Vulto-van Silfhout AT, Faivre L, Haan E, Gibbs RA, Meisler MH, Lee BH. Am J Hum Genet. 2013 May 2;92(5):781-91. doi: 10.1016/j.ajhg.2013.03.020.

Forensic parameters for 15 STRs in eight Amerindian populations from the north and west of Mexico.Rangel-Villalobos H, Martínez-Sevilla VM, Salazar-Flores J, Martínez-Cortez G, Muñoz-Valle JF, Galaviz-Hernández C, Lazalde-Ramos BP, Sosa-Macías M. Forensic Sci Int Genet. 2013 May;7(3):e62-5. doi: 10.1016/j.fsigen.2013.02.003.

Maternal admixture and population structure in Mexican-Mestizos based on mtDNA haplogroups.Martínez-Cortés G, Salazar-Flores J, Haro-Guerrero J, Rubi-Castellanos R, Velarde-Félix JS, Muñoz-Valle JF, López-Casamichana M, Carrillo-Tapia E, Canseco-Avila LM, Bravi CM, López-Armenta M, Rangel-Villalobos H. Am J Phys Anthropol. 2013 Aug;151(4):526-37. doi: 10.1002/ajpa.22293.

[Pharmacogenetics and antiepileptic drug metabolism: implication of genetic variants in cytochromes P450].Saldaña-Cruz AM, Sánchez-Corona J, Márquez de Santiago DA, García-Zapién AG, Flores-Martínez SE. Rev Neurol. 2013 May 1;56(9):471-9. Review. Spanish.

Analysis of the polymorphisms EGFR-r521K and ERBB2-I655V in Mexican patients with gastric cancer and premalignant gastric lesions.Torres-Jasso JH, Bustos-Carpinteyro AR, Marín ME, Santiago E, Leoner C, Flores-Luna L, Torres J, Sánchez-Lopez JY. Rev Invest Clin. 2013 Mar-Apr;65(2):150-5.

Identification of NIPBL, a new ETV6 partner gene in t(5;12) (p13;p13)-associated acute megakaryoblastic leukemia.de Braekeleer E, Auffret R, García JR, Padilla JM, Fletes CC, Morel F, Douet-Guilbert N, de Braekeleer M. Leuk Lymphoma. 2013 Feb;54(2):423-4. doi: 10.3109/10428194.2012.706288.

Co-occurrence of hemiscrotal agenesis with cutis marmorata telangiectatica congenita and hydronephrosis affecting the same side of the body.Corona-Rivera JR, Acosta-León J, León-Hernández MÁ, Martínez-Macías FJ, Bobadilla-Morales L, Corona-Rivera A. Am J Med Genet A. 2014 Jan;164A(1):199-203. doi: 10.1002/ajmg.a.36210.

Association of the FTO gene SNP rs17817449 with body fat distribution in Mexican women.Zermeño-Rivera JJ, Astocondor-Pérez JP, Valle Y, Padilla-Gutiérrez JR, Orozco-Castellanos R, Figuera LE, Gutiérrez-Amavizca BE. Genet Mol Res. 2014 Feb 13;13(4):8561-7. doi: 10.4238/2014.February.13.7.

Intron 4 VNTR (4a/b) polymorphism of the endothelial nitric oxide synthase gene is associated with breast cancer in Mexican women.Ramírez-Patiño R, Figuera LE, Puebla-Pérez AM, Delgado-Saucedo JI, Legazpí-Macias MM, Mariaud-Schmidt RP, Ramos-Silva A, Gutiérrez-Hurtado IA, Gómez Flores-Ramos L, Zúñiga-González GM, Gallegos-Arreola MP. J Korean Med Sci. 2013 Nov;28(11):1587-94. doi: 10.3346/jkms.2013.28.11.1587.

Association of the tumor necrosis factor-alpha -308G>A polymorphism with breast cancer in Mexican women.Gómez Flores-Ramos L, Escoto-De Dios A, Puebla-Pérez AM, Figuera-Villanueva LE, Ramos-Silva A, Ramírez-Patiño R, Delgado-Saucedo JI, Salas-González E, Zúñiga-González GM, Alonzo-Rojo A, Gutiérrez-Hurtado I, Gallegos-Arreola MP. Genet Mol Res. 2013 Nov 18;12(4):5680-93. doi: 10.4238/2013.November.18.17.